Review



chimeric guide rna expression plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc chimeric guide rna expression plasmid
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Chimeric Guide Rna Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 3002 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc12803845-387-29-34
    Average 96 stars, based on 3002 article reviews
    chimeric guide rna expression plasmid - by Bioz Stars, 2026-09
    96/100 stars

    Images

    1) Product Images from "A human blood-brain barrier model reveals pericytes as critical regulators of viral neuroinvasion"

    Article Title: A human blood-brain barrier model reveals pericytes as critical regulators of viral neuroinvasion

    Journal: iScience

    doi: 10.1016/j.isci.2025.114443

    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Figure Legend Snippet: Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

    Techniques Used: Derivative Assay, RNA Sequencing, Standard Deviation, RNA Expression, Expressing, Flow Cytometry, Immunofluorescence, Staining, Co-Culture Assay

    Related Articles

    RNA Expression:

    Article Title: CTCF mediates dosage- and sequence-context-dependent transcriptional insulation by forming local chromatin domains
    Article Snippet: .. Specifically, a guide RNA expression plasmid (pX330, addgene #42230) targeting the 3’ of the Sox2 gene, together with egfp and mcherry donor plasmids were co-electroporated into wild-type F123 cells by Neon transfection system (MPK1096). ..

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery
    Article Snippet: .. 2500 ng of purified HDR PCR product and 1500 ng of guide RNA expression plasmid (Addgene 49330) containing the relevant guide RNAs ( Supplementary Table 3 ) were transfected into 5 × 10 6 OSCs. ..

    Article Title: Triaging of α-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology.
    Article Snippet: To deplete multiple genes at once (see Figures 3 and 4) or to increase knock-down efficiency, we used a programmed dual sgRNA guide vector (Addgene, 140096) (see Table S5 for list of dual guide combinations and respective protospacer sequences). .. Tagging endogenous TTC1 in HEK293T cells with GFP was performed as previously described.114 The sgRNAwas generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene, 42230) with BbsI digestion (see Table S5 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene, 50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1C-terminus appendedwith the TTC1 protospacer + PAMsequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery.
    Article Snippet: 1Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), Vienna BioCenter (VBC), Vienna, Austria.. 2Vienna BioCenter PhD Program, Doctoral School of the University of Vienna and Medical University of Vienna, Vienna, Austria.. 3Structural Biology Program, Memorial Sloan Kettering Cancer Center, New York, NY, USA.

    Article Title: Triaging of ⍺-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology
    Article Snippet: .. The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene #50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1 C-terminus appended with the TTC1 protospacer + PAM sequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Article Title: Single-cell eQTL mapping in yeast reveals a tradeoff between growth and reproduction
    Article Snippet: Recombinant DNA reagent , p415 GalL-Cas9-Cyc1t (plasmid) , , RRID: Addgene_43804 , Gal inducible CAS9 with LEU cassette. .. Recombinant DNA reagent , SNR52p-gRNA(BstEII/SphI). CAN1.Y-SUP4t (plasmid) , , RRID: Addgene_98814 , Guide RNA expression plasmid with URA resistance. .. Recombinant DNA reagent , plk88+GPA1 novel variant (plasmid) , This paper , , Guide RNA and coupled repair template to change 82 W to 82 R in Gpa1.

    Plasmid Preparation:

    Article Title: CTCF mediates dosage- and sequence-context-dependent transcriptional insulation by forming local chromatin domains
    Article Snippet: .. Specifically, a guide RNA expression plasmid (pX330, addgene #42230) targeting the 3’ of the Sox2 gene, together with egfp and mcherry donor plasmids were co-electroporated into wild-type F123 cells by Neon transfection system (MPK1096). ..

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery
    Article Snippet: .. 2500 ng of purified HDR PCR product and 1500 ng of guide RNA expression plasmid (Addgene 49330) containing the relevant guide RNAs ( Supplementary Table 3 ) were transfected into 5 × 10 6 OSCs. ..

    Article Title: Triaging of α-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology.
    Article Snippet: To deplete multiple genes at once (see Figures 3 and 4) or to increase knock-down efficiency, we used a programmed dual sgRNA guide vector (Addgene, 140096) (see Table S5 for list of dual guide combinations and respective protospacer sequences). .. Tagging endogenous TTC1 in HEK293T cells with GFP was performed as previously described.114 The sgRNAwas generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene, 42230) with BbsI digestion (see Table S5 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene, 50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1C-terminus appendedwith the TTC1 protospacer + PAMsequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery.
    Article Snippet: 1Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), Vienna BioCenter (VBC), Vienna, Austria.. 2Vienna BioCenter PhD Program, Doctoral School of the University of Vienna and Medical University of Vienna, Vienna, Austria.. 3Structural Biology Program, Memorial Sloan Kettering Cancer Center, New York, NY, USA.

    Article Title: Triaging of ⍺-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology
    Article Snippet: .. The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene #50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1 C-terminus appended with the TTC1 protospacer + PAM sequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Article Title: Single-cell eQTL mapping in yeast reveals a tradeoff between growth and reproduction
    Article Snippet: Recombinant DNA reagent , p415 GalL-Cas9-Cyc1t (plasmid) , , RRID: Addgene_43804 , Gal inducible CAS9 with LEU cassette. .. Recombinant DNA reagent , SNR52p-gRNA(BstEII/SphI). CAN1.Y-SUP4t (plasmid) , , RRID: Addgene_98814 , Guide RNA expression plasmid with URA resistance. .. Recombinant DNA reagent , plk88+GPA1 novel variant (plasmid) , This paper , , Guide RNA and coupled repair template to change 82 W to 82 R in Gpa1.

    Transfection:

    Article Title: CTCF mediates dosage- and sequence-context-dependent transcriptional insulation by forming local chromatin domains
    Article Snippet: .. Specifically, a guide RNA expression plasmid (pX330, addgene #42230) targeting the 3’ of the Sox2 gene, together with egfp and mcherry donor plasmids were co-electroporated into wild-type F123 cells by Neon transfection system (MPK1096). ..

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery
    Article Snippet: .. 2500 ng of purified HDR PCR product and 1500 ng of guide RNA expression plasmid (Addgene 49330) containing the relevant guide RNAs ( Supplementary Table 3 ) were transfected into 5 × 10 6 OSCs. ..

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery.
    Article Snippet: 1Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), Vienna BioCenter (VBC), Vienna, Austria.. 2Vienna BioCenter PhD Program, Doctoral School of the University of Vienna and Medical University of Vienna, Vienna, Austria.. 3Structural Biology Program, Memorial Sloan Kettering Cancer Center, New York, NY, USA.

    Purification:

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery
    Article Snippet: .. 2500 ng of purified HDR PCR product and 1500 ng of guide RNA expression plasmid (Addgene 49330) containing the relevant guide RNAs ( Supplementary Table 3 ) were transfected into 5 × 10 6 OSCs. ..

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery.
    Article Snippet: 1Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), Vienna BioCenter (VBC), Vienna, Austria.. 2Vienna BioCenter PhD Program, Doctoral School of the University of Vienna and Medical University of Vienna, Vienna, Austria.. 3Structural Biology Program, Memorial Sloan Kettering Cancer Center, New York, NY, USA.

    Polymerase Chain Reaction:

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery
    Article Snippet: .. 2500 ng of purified HDR PCR product and 1500 ng of guide RNA expression plasmid (Addgene 49330) containing the relevant guide RNAs ( Supplementary Table 3 ) were transfected into 5 × 10 6 OSCs. ..

    Article Title: Panoramix SUMOylation on chromatin connects the piRNA pathway to the cellular heterochromatin machinery.
    Article Snippet: 1Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), Vienna BioCenter (VBC), Vienna, Austria.. 2Vienna BioCenter PhD Program, Doctoral School of the University of Vienna and Medical University of Vienna, Vienna, Austria.. 3Structural Biology Program, Memorial Sloan Kettering Cancer Center, New York, NY, USA.

    Generated:

    Article Title: Triaging of α-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology.
    Article Snippet: To deplete multiple genes at once (see Figures 3 and 4) or to increase knock-down efficiency, we used a programmed dual sgRNA guide vector (Addgene, 140096) (see Table S5 for list of dual guide combinations and respective protospacer sequences). .. Tagging endogenous TTC1 in HEK293T cells with GFP was performed as previously described.114 The sgRNAwas generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene, 42230) with BbsI digestion (see Table S5 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene, 50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1C-terminus appendedwith the TTC1 protospacer + PAMsequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Article Title: Triaging of ⍺-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology
    Article Snippet: .. The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene #50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1 C-terminus appended with the TTC1 protospacer + PAM sequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Cloning:

    Article Title: Triaging of α-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology.
    Article Snippet: To deplete multiple genes at once (see Figures 3 and 4) or to increase knock-down efficiency, we used a programmed dual sgRNA guide vector (Addgene, 140096) (see Table S5 for list of dual guide combinations and respective protospacer sequences). .. Tagging endogenous TTC1 in HEK293T cells with GFP was performed as previously described.114 The sgRNAwas generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene, 42230) with BbsI digestion (see Table S5 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene, 50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1C-terminus appendedwith the TTC1 protospacer + PAMsequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Article Title: Triaging of ⍺-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology
    Article Snippet: .. The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene #50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1 C-terminus appended with the TTC1 protospacer + PAM sequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Sequencing:

    Article Title: Triaging of α-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology.
    Article Snippet: To deplete multiple genes at once (see Figures 3 and 4) or to increase knock-down efficiency, we used a programmed dual sgRNA guide vector (Addgene, 140096) (see Table S5 for list of dual guide combinations and respective protospacer sequences). .. Tagging endogenous TTC1 in HEK293T cells with GFP was performed as previously described.114 The sgRNAwas generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene, 42230) with BbsI digestion (see Table S5 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene, 50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1C-terminus appendedwith the TTC1 protospacer + PAMsequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Article Title: Triaging of ⍺-helical proteins to the mitochondrial outer membrane by distinct chaperone machinery based on substrate topology
    Article Snippet: .. The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence). .. The donor plasmid was cloned into the empty backbone pUC19 cloning vector (Addgene #50005) digested with SaII and KpnI – the 5’ and 3’ homology arms at the TTC1 C-terminus appended with the TTC1 protospacer + PAM sequence on both ends, and the 20xGS-linker + sfGFP insert were amplified from IDT-synthesized gene blocks and cloned into the digested backbone by Gibson assembly.

    Recombinant:

    Article Title: Single-cell eQTL mapping in yeast reveals a tradeoff between growth and reproduction
    Article Snippet: Recombinant DNA reagent , p415 GalL-Cas9-Cyc1t (plasmid) , , RRID: Addgene_43804 , Gal inducible CAS9 with LEU cassette. .. Recombinant DNA reagent , SNR52p-gRNA(BstEII/SphI). CAN1.Y-SUP4t (plasmid) , , RRID: Addgene_98814 , Guide RNA expression plasmid with URA resistance. .. Recombinant DNA reagent , plk88+GPA1 novel variant (plasmid) , This paper , , Guide RNA and coupled repair template to change 82 W to 82 R in Gpa1.



    Similar Products

    chimeric guide rna expression plasmid  (Addgene inc)
    96
    Addgene inc chimeric guide rna expression plasmid
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Chimeric Guide Rna Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc12803845-387-29-34
    Average 96 stars, based on 1 article reviews
    chimeric guide rna expression plasmid - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    aav u6 sgrna hsyn mcherry vectors expressed single guide rna sgrna  (Addgene inc)
    93
    Addgene inc aav u6 sgrna hsyn mcherry vectors expressed single guide rna sgrna
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Aav U6 Sgrna Hsyn Mcherry Vectors Expressed Single Guide Rna Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/AAV-U6-sgRNA-hSyn-mCherry+(Plasmid+%2387916)/bio_rxiv__64898__2025__12__10__693421-51-0-7
    Average 93 stars, based on 1 article reviews
    aav u6 sgrna hsyn mcherry vectors expressed single guide rna sgrna - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    mlm3636 guide rna expression plasmid  (Addgene inc)
    95
    Addgene inc mlm3636 guide rna expression plasmid
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Mlm3636 Guide Rna Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/MLM3636+(Plasmid+%2343860)/pmc12501846__pgaf297_supplementary_data-7-35-49
    Average 95 stars, based on 1 article reviews
    mlm3636 guide rna expression plasmid - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    guide rna expression plasmid lenti crispr v2  (Addgene inc)
    96
    Addgene inc guide rna expression plasmid lenti crispr v2
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Guide Rna Expression Plasmid Lenti Crispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/lentiCRISPR+v2+(Plasmid+%2352961)/pmc12456019-240-28-33
    Average 96 stars, based on 1 article reviews
    guide rna expression plasmid lenti crispr v2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    guide rna lentiviral expression vector  (Addgene inc)
    95
    Addgene inc guide rna lentiviral expression vector
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Guide Rna Lentiviral Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/lenti+sgRNA(MS2)_zeo+backbone+(Plasmid+%2361427)/pmc10372678__pnas__2305187120__sapp-96-17-22
    Average 95 stars, based on 1 article reviews
    guide rna lentiviral expression vector - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    guide rna expression plasmid px459  (Addgene inc)
    96
    Addgene inc guide rna expression plasmid px459
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Guide Rna Expression Plasmid Px459, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm40641422-437-13-20
    Average 96 stars, based on 1 article reviews
    guide rna expression plasmid px459 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    guide rna expression plasmid lentiguide puro  (Addgene inc)
    96
    Addgene inc guide rna expression plasmid lentiguide puro
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Guide Rna Expression Plasmid Lentiguide Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/lentiGuide-Puro+(Plasmid+%2352963)/pmc12210241-581-14-18
    Average 96 stars, based on 1 article reviews
    guide rna expression plasmid lentiguide puro - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

    Journal: iScience

    Article Title: A human blood-brain barrier model reveals pericytes as critical regulators of viral neuroinvasion

    doi: 10.1016/j.isci.2025.114443

    Figure Lengend Snippet: Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

    Article Snippet: For generation of fluorescently-tagged hPSC lines EGFP or tdTM was inserted into the AAVS1 locus with a targeting plasmid (Addgene; catalog no. 22212) and a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid (Addgene; catalog no. 42230), into which the Target Guide Sequence was cloned into using the oligos: Oligo 1: CACCG GGGGCCACTAGGGACAGGAT,Oligo2 : AAAC ATCCTGTCCCTAGTGGCCCC C. After puromycin selection, EGFP or tdTM-expressing clones were manually picked.

    Techniques: Derivative Assay, RNA Sequencing, Standard Deviation, RNA Expression, Expressing, Flow Cytometry, Immunofluorescence, Staining, Co-Culture Assay